CB6-GFP-TAOK2 (K57A)
(Plasmid #197114)

• Purpose: Expression of kinase-deficient GFP-tagged TAOK2 (K57A) / PSK1 (K57A) in mammalian cells
• Depositing Lab: Jonathan Morris
• Publication: Garg et al J Cell Sci. 2020 Mar 16;133(6):jcs235895. doi: 10.1242/jcs.235895.

Backbone

• Vector backbone: N-GFP-CB6
• Backbone manufacturer: Michael Way
• Backbone size w/o insert (bp): 7000
• Total vector size (bp): 10704
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TAOK2 (K57A)
• Alt name: PSK1 (K57A)
• Species: H. sapiens (human)
• Insert Size (bp): 3705
• Mutation: Changed K 57 to A
• GenBank ID: 9344
• Entrez Gene: TAOK2 (a.k.a. MAP3K17, PSK, PSK1, PSK1-BETA, TAO1, TAO2, Tao2beta)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hind111 (not destroyed)
• 3′ cloning site: EcoR1 (not destroyed)
• 5′ sequencing primer: TCACATGGTCCTGCTGGAGTT (GFP forward primer)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Cloned by Jonathan Morris at KCL (subject to MTA with Addgene).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plese note: This construct originated from a T47-D breast carcinoma cell cDNA library and contains the R1211H variant in PSK1/TAOK2.