Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CB6-GFP-TAOK2 (K57A)
(Plasmid #197114)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197114 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    N-GFP-CB6
  • Backbone manufacturer
    Michael Way
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 10704
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TAOK2 (K57A)
  • Alt name
    PSK1 (K57A)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3705
  • Mutation
    Changed K 57 to A
  • GenBank ID
    9344
  • Entrez Gene
    TAOK2 (a.k.a. MAP3K17, PSK, PSK1, PSK1-BETA, TAO1, TAO2, Tao2beta)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind111 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer TCACATGGTCCTGCTGGAGTT (GFP forward primer)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cloned by Jonathan Morris at KCL (subject to MTA with Addgene).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plese note: This construct originated from a T47-D breast carcinoma cell cDNA library and contains the R1211H variant in PSK1/TAOK2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CB6-GFP-TAOK2 (K57A) was a gift from Jonathan Morris (Addgene plasmid # 197114 ; http://n2t.net/addgene:197114 ; RRID:Addgene_197114)
  • For your References section:

    Rnd3 interacts with TAO kinases and contributes to mitotic cell rounding and spindle positioning. Garg R, Koo CY, Infante E, Giacomini C, Ridley AJ, Morris JDH. J Cell Sci. 2020 Mar 16;133(6):jcs235895. doi: 10.1242/jcs.235895. 10.1242/jcs.235895 PubMed 32041905