CB6-GFP-TAOK1
(Plasmid #197108)

• Purpose: Expression of GFP-tagged TAOK1 / PSK2 in mammalian cells
• Depositing Lab: Jonathan Morris
• Publication: Garg et al J Cell Sci. 2020 Mar 16;133(6):jcs235895. doi: 10.1242/jcs.235895.

Backbone

• Vector backbone: N-GFP-CB6
• Backbone manufacturer: Michael Way
• Backbone size w/o insert (bp): 7000
• Total vector size (bp): 10705
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TAOK1
• Alt name: PSK2
• Alt name: KIAA1361
• Species: H. sapiens (human)
• Insert Size (bp): 3705
• Mutation: Wild Type
• GenBank ID: 57551
• Entrez Gene: TAOK1 (a.k.a. DDIB, KFC-B, MAP3K16, MARKK, PSK-2, PSK2, TAO1, hKFC-B, hTAOK1)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (not destroyed)
• 3′ cloning site: BamH1 (not destroyed)
• 5′ sequencing primer: TCACATGGTCCTGCTGGAGTT (GFP forward primer)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Cloned by Jonathan Morris at KCL (subject to MTA with Addgene).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry