pLKO-TRE-AFOS
(Plasmid #197079)

• Purpose: A doxycycline inducible dominant negative form of transcription complex AP1. AFOS heterodimerizes and inhibits c-Jun. Plasmid contains PGK driven H2B-RFP as a fluorescent reporter of transduction.
• Depositing Lab: Elaine Fuchs
• Publication: Larsen et al Cell Stem Cell. 2021 Oct 7;28(10):1758-1774.e8. doi: 10.1016/j.stem.2021.07.001. Epub 2021 Jul 27.

Backbone

• Vector backbone: pLKO
• Backbone size w/o insert (bp): 7659
• Total vector size (bp): 7960
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: AFOS
• Species: M. musculus (mouse)
• Insert Size (bp): 301
• Entrez Gene: Fos (a.k.a. D12Rfj1, c-fos, cFos)
• Promoter: TRE
• Tags / Fusion Proteins:
  • Flag (N terminal on insert)
  • T7 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CTCCATAGAAGACACCGGGAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene plasmid #33353 (CMV500 A-Fos)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry