pCAG-FRT-stop-FRT(FSF)- loxP-stop-loxP(LSL)-SP-HA-HRPtm-WPRE-bGHpolyA
(Plasmid
#197044)
-
PurposeIn situ cell-surface proteome extraction by extracellular labeling (iPEEL)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBT378
- Backbone size w/o insert (bp) 6249
- Total vector size (bp) 9446
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namepCAG-FSF-LSL
-
SpeciesS. cerevisiae (budding yeast); P1 bacteriophage
-
Insert Size (bp)933
- Promoter pCAG
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCAACGTGCTGGTTATTGT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSP-HA-HRPtm
-
SpeciesSynthetic
-
Insert Size (bp)1215
- Promoter pCAG
-
Tag
/ Fusion Protein
- HA, myc
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer aagctagatcgaattcggcc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameWPRE-bGHpolyA
-
SpeciesSynthetic; Woodchuck Hepatitis Virus
-
Insert Size (bp)797
- Promoter pCAG
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gctccttttacgctatgtgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-FRT-stop-FRT(FSF)- loxP-stop-loxP(LSL)-SP-HA-HRPtm-WPRE-bGHpolyA was a gift from Liqun Luo (Addgene plasmid # 197044 ; http://n2t.net/addgene:197044 ; RRID:Addgene_197044) -
For your References section:
In situ cell-type-specific cell-surface proteomic profiling in mice. Shuster SA, Li J, Chon U, Sinantha-Hu MC, Luginbuhl DJ, Udeshi ND, Carey DK, Takeo YH, Xie Q, Xu C, Mani DR, Han S, Ting AY, Carr SA, Luo L. Neuron. 2022 Dec 7;110(23):3882-3896.e9. doi: 10.1016/j.neuron.2022.09.025. Epub 2022 Oct 10. 10.1016/j.neuron.2022.09.025 PubMed 36220098