pSECRETS-B
(Plasmid #196987)

• Purpose: For SECRETS protocol to screen for gRNA activity and specificity: BsaI cassette for gRNA expression or for cloning (x-)gRNA librarys + off-target for SECRETS counter-selection.
• Depositing Lab: Eric Josephs
• Publication: Herring-Nicholas et al Commun Biol. 2024 Jan 12;7(1):86. doi: 10.1038/s42003-024-05776-8.

Backbone

• Vector backbone: pBbS2k-RFP
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4500
• Modifications to backbone: TetR placed on pAmp promoter
• Vector type: Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Spy gRNA cassette
• Species: Synthetic
• Insert Size (bp): 500
• Promoter: pltetO1

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGCGGATACATATTTGAATG
• 3′ sequencing primer: AAGTTGATAACGGACTAGCC

Resource Information

• Supplemental Documents:
  • pSECRETS-B.gb
• A portion of this plasmid was derived from a plasmid made by: Vector: pBbS2k-RFP (Plasmid #35330); insert: synthesized from IDT.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Protocol to clone pSECRETS-B derivatives containing off-target sequences and standard gRNAs (or x-gRNA libraries) using USER available in reference.