pSECRETS-A
(Plasmid #196986)

• Purpose: For SECRETS protocol to screen for gRNA activity and specificity: bacterial expression Cas9 in the presence of anhydrotetracycline (aTc).
• Depositing Lab: Eric Josephs
• Publication: Herring-Nicholas et al Commun Biol. 2024 Jan 12;7(1):86. doi: 10.1038/s42003-024-05776-8.

Backbone

• Vector backbone: pBbA2c-RFP
• Backbone size w/o insert (bp): 2800
• Total vector size (bp): 7000
• Modifications to backbone: TetR placed under pAmp promoter
• Vector type: Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: S. pyogenes Cas9
• Species: Streptococcus pyogenes
• Insert Size (bp): 4107
• Promoter: pltetO1

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGCGAGTTTACGGGTTGTTA
• 3′ sequencing primer: AGTCACACTGGCTCACCTTC

Resource Information

• Supplemental Documents:
  • pSECRETS-A.gb
• A portion of this plasmid was derived from a plasmid made by: Vector: pBbA2c-RFP (Plasmid #35326); insert: pwtCas9-bacteria (Plasmid #44250); additional insert synthesized from IDT.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry