Skip to main content
Addgene

Fragment1 with TLS2
(Plasmid #196983)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196983 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pENTR4
  • Total vector size (bp) 3032
  • Vector type
    Gateway-compatible entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Intermediate fragment for assembly of gRNA-TLS2 construct
  • Species
    A. thaliana (mustard weed); Streptococcus pyogenes
  • Insert Size (bp)
    765

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GGCCATCCTGACGGATGGCC
  • 3′ sequencing primer GGCCTCGACGTTTCCCGTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please refer to the GO CRISP Cloning Protocol linked above for additional information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Fragment1 with TLS2 was a gift from Friedrich Kragler (Addgene plasmid # 196983 ; http://n2t.net/addgene:196983 ; RRID:Addgene_196983)
  • For your References section:

    Heritable transgene-free genome editing in plants by grafting of wild-type shoots to transgenic donor rootstocks. Yang L, Machin F, Wang S, Saplaoura E, Kragler F. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01585-8. 10.1038/s41587-022-01585-8 PubMed 36593415