pGEX-6p-1_GST-DmKHC[1-421]_1xmNeonGreen
(Plasmid #196974)

• Purpose: Bacterial expression plasmid for GST-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal mNeonGreen tag and cleavable N-terminal GST tag
• Depositing Lab: Lukas Kapitein
• Publication: Chen et al Elife. 2022 Jul 5;11:e77892. doi: 10.7554/eLife.77892.

Backbone

• Vector backbone: pGEX-6p-1
• Backbone size w/o insert (bp): 4944
• Total vector size (bp): 6924
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Purification from BL21. Induce protein expression with IPTG. After induction, grow at 18 degrees C.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Kinesin Heavy Chain
• Alt name: KHC, Khc, kinesin-1
• Species: D. melanogaster (fly)
• Insert Size (bp): 1980
• Entrez Gene: Khc (a.k.a. Dmel_CG7765, 2R6, CG7765, DK, DKH, Dm KHC, DmK, DmKHC, Dmel\CG7765, Dmkin, KHC, KIF 5A, KIF5, KIF5B, KIN, Kif5, Kin, Kin-1, Kinesin, Kinesin-1, khc, kin, kinesin, kinesin-1, l(2)W12, l(2)k13219, l(2)k13314, l(2R)W12, pgs)
• Promoter: tac
• Tags / Fusion Proteins:
  • GST (N terminal on insert)
  • mNeonGreen (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGCAAGCCACGTTTGGTG
• 3′ sequencing primer: GGAGCTGCATGTGTCAGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry