Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX-6p-1_GST-DmKHC[1-421]-1xGFP
(Plasmid #196973)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196973 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX-6p-1
  • Backbone size w/o insert (bp) 4944
  • Total vector size (bp) 6933
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Purification from BL21. Induce protein expression with IPTG. After induction, grow at 18 degrees C.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Kinesin Heavy Chain
  • Alt name
    KHC, Khc, kinesin-1
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1988
  • Entrez Gene
    Khc (a.k.a. Dmel_CG7765, 2R6, CG7765, DK, DKH, Dm KHC, DmK, DmKHC, Dmel\CG7765, Dmkin, KHC, KIF 5A, KIF5, KIF5B, KIN, Kif5, Kin, Kin-1, Kinesin, Kinesin-1, khc, kin, kinesin, kinesin-1, l(2)W12, l(2)k13219, l(2)k13314, l(2R)W12, pgs)
  • Promoter tac
  • Tags / Fusion Proteins
    • GST (N terminal on insert)
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCAAGCCACGTTTGGTG
  • 3′ sequencing primer GGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-6p-1_GST-DmKHC[1-421]-1xGFP was a gift from Lukas Kapitein (Addgene plasmid # 196973 ; http://n2t.net/addgene:196973 ; RRID:Addgene_196973)