mCherry-APP-mGFP
(Plasmid
#196704)
-
PurposeExpresses APP695 with two fluorescent proteins at the ends to follow processing in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196704 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV6-AN-mGFP
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 9400
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAmyloid Precursor Protein 695 isoform
-
Alt nameamyloid beta precursor protein, APP, APP695
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3500
-
Entrez GeneAPP (a.k.a. AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2, alpha-sAPP, preA4)
-
Tags
/ Fusion Proteins
- mCherry (N terminal on insert)
- mEGFP (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGACTTTCCAAAATGTCG
- 3′ sequencing primer CCCACCAGCCTTGTCCTAAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-APP-mGFP was a gift from Martino Calamai (Addgene plasmid # 196704 ; http://n2t.net/addgene:196704 ; RRID:Addgene_196704) -
For your References section:
APP and Bace1: Differential effect of cholesterol enrichment on processing and plasma membrane mobility. Capitini C, Bigi A, Parenti N, Emanuele M, Bianchi N, Cascella R, Cecchi C, Maggi L, Annunziato F, Pavone FS, Calamai M. iScience. 2023 Apr 11;26(5):106611. doi: 10.1016/j.isci.2023.106611. eCollection 2023 May 19. 10.1016/j.isci.2023.106611 PubMed 37128606