HA-BACE1-mBFP
(Plasmid #196697)

• Purpose: Expresses Bace1 with an HA tag at N-terminal for single molecule tracking and other measusers in mammalian cells
• Depositing Lab: Martino Calamai
• Publication: Capitini et al iScience. 2023 Apr 11;26(5):106611. doi: 10.1016/j.isci.2023.106611. eCollection 2023 May 19.

Backbone

• Vector backbone: pCMV6-Entry
• Backbone manufacturer: Origene
• Backbone size w/o insert (bp): 4800
• Total vector size (bp): 7000
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Beta-secretase 1
• Alt name: BACE1, beta-site amyloid precursor protein cleaving enzyme 1, beta-site APP cleaving enzyme 1
• Species: H. sapiens (human)
• Insert Size (bp): 2300
• GenBank ID: NM_012104 23621
• Entrez Gene: BACE1 (a.k.a. ASP2, BACE, HSPC104)
• Tags / Fusion Proteins:
  • HA (N terminal on insert)
  • mBFP (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGACTTTCCAAAATGTCG
• 3′ sequencing primer: CCCACCAGCCTTGTCCTAAT

Resource Information

• Supplemental Documents:
  • HA-Bace1-mTagBFP2.str

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry