Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mBFP-APPP1-mGFP
(Plasmid #196695)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196695 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV6-AN-mGFP
  • Backbone manufacturer
    Origene
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 9400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Amyloid Precursor Protein 695 isoform
  • Alt name
    amyloid beta precursor protein, APP, APP695
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3499
  • Mutation
    Lys to Val substitution at position 612
  • Entrez Gene
    APP (a.k.a. AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2, alpha-sAPP, preA4)
  • Promoter CMV
  • Tags / Fusion Proteins
    • mtagBFP2 (N terminal on insert)
    • mEGFP (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGACTTTCCAAAATGTCG
  • 3′ sequencing primer CCCACCAGCCTTGTCCTAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mBFP-APPP1-mGFP was a gift from Martino Calamai (Addgene plasmid # 196695 ; http://n2t.net/addgene:196695 ; RRID:Addgene_196695)
  • For your References section:

    APP and Bace1: Differential effect of cholesterol enrichment on processing and plasma membrane mobility. Capitini C, Bigi A, Parenti N, Emanuele M, Bianchi N, Cascella R, Cecchi C, Maggi L, Annunziato F, Pavone FS, Calamai M. iScience. 2023 Apr 11;26(5):106611. doi: 10.1016/j.isci.2023.106611. eCollection 2023 May 19. 10.1016/j.isci.2023.106611 PubMed 37128606