Skip to main content
Addgene

ptRNAfMet-A37U
(Plasmid #196659)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196659 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSEVA361
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    tRNAfMet-A37U expression cassette
  • Species
    E. coli
  • Mutation
    A37U in tRNAfMet
  • Promoter metY native promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGGGACCCCTGGATTCTCAC
  • 3′ sequencing primer TACTCAGGAGAGCGTTCACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ptRNAfMet-A37U was a gift from Markus Jeschek (Addgene plasmid # 196659 ; http://n2t.net/addgene:196659 ; RRID:Addgene_196659)
  • For your References section:

    Ultradeep characterisation of translational sequence determinants refutes rare-codon hypothesis and unveils quadruplet base pairing of initiator tRNA and transcript. Hollerer S, Jeschek M. Nucleic Acids Res. 2023 Mar 21;51(5):2377-2396. doi: 10.1093/nar/gkad040. 10.1093/nar/gkad040 PubMed 36727459