Skip to main content
Addgene

pBAD-6xHis-BglII
(Plasmid #196654)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196654 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGLO
  • Backbone manufacturer
    Bio-Rad
  • Backbone size (bp) 5371
  • Modifications to backbone
    Insertion of a linker in the original NheI site, coding for 6xHis tag and BglII site
  • Vector type
    Bacterial Expression
  • Tag / Fusion Protein
    • 6xHis tag (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tctctactgtttctccatacccg
  • 3′ sequencing primer atcagaccgcttctgcgttc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-6xHis-BglII was a gift from Franco Lucchini (Addgene plasmid # 196654 ; http://n2t.net/addgene:196654 ; RRID:Addgene_196654)

  • For your References section:

    siRNAs pools generated in Escherichia coli exhibit strong RNA-interference activity against influenza virus genomic sequences. Villa R, Renzi S, Dotti S, Lucchini F. Virology. 2022 Dec 31;579:38-45. doi: 10.1016/j.virol.2022.12.013. 10.1016/j.virol.2022.12.013 PubMed 36599198
Related items: