Skip to main content
Addgene

pLentiCRISPRv2_mSTING_scrambled_gRNA_2
(Plasmid #196628)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196628 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLentiCRISPRv2
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mSTING scrambled gRNA 2
  • gRNA/shRNA sequence
    GCCGTTGCCGACGGTACGTG
  • Species
    M. musculus (mouse)
  • Mutation
    WT

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2_mSTING_scrambled_gRNA_2 was a gift from Nicolas Manel (Addgene plasmid # 196628 ; http://n2t.net/addgene:196628 ; RRID:Addgene_196628)
  • For your References section:

    Selective STING stimulation in dendritic cells primes antitumor T cell responses. Jneid B, Bochnakian A, Hoffmann C, Delisle F, Djacoto E, Sirven P, Denizeau J, Sedlik C, Gerber-Ferder Y, Fiore F, Akyol R, Brousse C, Kramer R, Walters I, Carlioz S, Salmon H, Malissen B, Dalod M, Piaggio E, Manel N. Sci Immunol. 2023 Jan 13;8(79):eabn6612. doi: 10.1126/sciimmunol.abn6612. Epub 2023 Jan 13. 10.1126/sciimmunol.abn6612 PubMed 36638189