GA46
(Plasmid #196614)

• Purpose: Plasmid used for the C-terminal tagging of Atp3 with mCherry and the auxin-inducible degron in yeast
• Depositing Lab: Matthias Heinemann
• Publication: Takhaveev et al Nat Metab. 2023 Feb;5(2):294-313. doi: 10.1038/s42255-023-00741-x. Epub 2023 Feb 27.

Backbone

• Vector backbone: pG23A, originally HO-poly-KanMX4-HO
• Backbone manufacturer: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC55758/
• Backbone size w/o insert (bp): 2531
• Total vector size (bp): 5859
• Vector type: Yeast Expression
• Selectable markers: NatMX (select with Nourseotrichin)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATP3::mCherry-AID(71-114)-NatMX
• Alt name: YBR039W
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 3328
• Entrez Gene: ATP3 (a.k.a. YBR039W)
• Tags / Fusion Proteins:
  • mCherry (C terminal on insert)
  • AID(71-114) (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTGTCAAGGAGGGTATTCTGG
• 3′ sequencing primer: CCTTGAAGCGCATGAACTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloning details are provided in Supplementary Table 2 of the paper. Details of the parent plasmid pG23A can be found on Addgene (Plasmid #102884).