pROS_phleo-Tps1/Gsy2
(Plasmid
#196612)
-
PurposeEncoding guide RNAs for the knock out of TPS1 and GSY2 genes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepROS13
-
Modifications to backboneThe kanMX cassette in pROS13 was replaced by the pAgTEF1-ble-tAgTEF1 cassette from pUG66 conveying phleomycin resistance.
-
Vector typeYeast Expression
-
Selectable markersPhleomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACCTTTCGAGAGGACGATG
- 3′ sequencing primer GCTGGCCTTTTGCTCACATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning details are in the Methods section and Supplementary Table 2 of the paper.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pROS_phleo-Tps1/Gsy2 was a gift from Matthias Heinemann (Addgene plasmid # 196612 ; http://n2t.net/addgene:196612 ; RRID:Addgene_196612) -
For your References section:
Temporal segregation of biosynthetic processes is responsible for metabolic oscillations during the budding yeast cell cycle. Takhaveev V, Ozsezen S, Smith EN, Zylstra A, Chaillet ML, Chen H, Papagiannakis A, Milias-Argeitis A, Heinemann M. Nat Metab. 2023 Feb;5(2):294-313. doi: 10.1038/s42255-023-00741-x. Epub 2023 Feb 27. 10.1038/s42255-023-00741-x PubMed 36849832