Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLentiCRISPRv1 sgTollip
(Plasmid #196546)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196546 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLentiCRISPRv1
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Toll-Interacting Protein
  • Alt name
    IL-1RAcPIP
  • gRNA/shRNA sequence
    ACCACCGTCAGCACTCAGCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    TOLLIP (a.k.a. IL-1RAcPIP)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv1 sgTollip was a gift from David Tumbarello (Addgene plasmid # 196546 ; http://n2t.net/addgene:196546 ; RRID:Addgene_196546)
  • For your References section:

    Tollip coordinates Parkin-dependent trafficking of mitochondrial-derived vesicles. Ryan TA, Phillips EO, Collier CL, Jb Robinson A, Routledge D, Wood RE, Assar EA, Tumbarello DA. EMBO J. 2020 Jun 2;39(11):e102539. doi: 10.15252/embj.2019102539. Epub 2020 Apr 20. 10.15252/embj.2019102539 PubMed 32311122