pLentiCRISPRv1 sgTollip
(Plasmid
#196546)
-
PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLentiCRISPRv1
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameToll-Interacting Protein
-
Alt nameIL-1RAcPIP
-
gRNA/shRNA sequenceACCACCGTCAGCACTCAGCG
-
SpeciesH. sapiens (human)
-
Entrez GeneTOLLIP (a.k.a. IL-1RAcPIP)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv1 sgTollip was a gift from David Tumbarello (Addgene plasmid # 196546 ; http://n2t.net/addgene:196546 ; RRID:Addgene_196546) -
For your References section:
Tollip coordinates Parkin-dependent trafficking of mitochondrial-derived vesicles. Ryan TA, Phillips EO, Collier CL, Jb Robinson A, Routledge D, Wood RE, Assar EA, Tumbarello DA. EMBO J. 2020 Jun 2;39(11):e102539. doi: 10.15252/embj.2019102539. Epub 2020 Apr 20. 10.15252/embj.2019102539 PubMed 32311122