Skip to main content
Addgene

plentiCMV10x-sct-pp65-b2m-HLA-A0201
(Plasmid #196513)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196513 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLentiCMV-WPRE
  • Backbone size w/o insert (bp) 6647
  • Total vector size (bp) 7200
  • Modifications to backbone
    add TSO and PCR amplification handle sequences that are compatible with 10xGenomics 5' single cell RNA-seq kit
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    NA

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    single chain of a pp65 peptide, b2m and HLA A0201
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1462
  • Mutation
    Y84C, 10xgenomics compatible tag
  • Promoter CMV
  • Tag / Fusion Protein
    • NA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTAGGCGTGTACGGTGGGAG
  • 3′ sequencing primer AAGCAGCGTATCCACATAGCG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plentiCMV10x-sct-pp65-b2m-HLA-A0201 was a gift from Howard Chang (Addgene plasmid # 196513 ; http://n2t.net/addgene:196513 ; RRID:Addgene_196513)

  • For your References section:

    Engineered cell entry links receptor biology with single-cell genomics. Yu B, Shi Q, Belk JA, Yost KE, Parker KR, Li R, Liu BB, Huang H, Lingwood D, Greenleaf WJ, Davis MM, Satpathy AT, Chang HY. Cell. 2022 Dec 22;185(26):4904-4920.e22. doi: 10.1016/j.cell.2022.11.016. Epub 2022 Dec 13. 10.1016/j.cell.2022.11.016 PubMed 36516854
Related items:
Commonly requested with: