Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXOOY
(Plasmid #196449)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196449 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pXOOY
  • Backbone size (bp) 9054
  • Vector type
    Yeast Expression ; Expression in Xenopus laevis
  • Promoter yeast CYC-GAL and T7 promoter
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GACTCACTATAGGGTAAATTAC
  • 3′ sequencing primer TAGAGACTCCATTCGGGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note Addgene NGS identified a few base pairs in the UTR that are a mixed population. This does not affect plasmid function.

The dual expression plasmid carries elements from the yeast pEMBLyex4 plasmid and the mammalian cell-Xenopus laevis dual expression vector pXOOM.

pEMBLyex4 reference: Baldari, C.; Cesareni, G. Plasmids pEMBLY: New single-stranded shuttle vectors for the recovery and analysis of yeast DNA sequences. Gene 1985, 35, 27–32.

pXOOM reference: Dual-function vector for protein expression in both mammalian cells and Xenopus laevis oocytes T Jespersen 1, M Grunnet, K Angelo, D A Klaerke, S P Olesen Biotechniques. 2002 Mar;32(3):536-8, 540. doi: 10.2144/02323st05.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXOOY was a gift from Per Amstrup Pedersen (Addgene plasmid # 196449 ; http://n2t.net/addgene:196449 ; RRID:Addgene_196449)
  • For your References section:

    pXOOY: A dual-function vector for expression of membrane proteins in Saccharomyces cerevisiae and Xenopus laevis oocytes. Vold VA, Glanville S, Klaerke DA, Pedersen PA. PLoS One. 2023 Feb 21;18(2):e0281868. doi: 10.1371/journal.pone.0281868. eCollection 2023. 10.1371/journal.pone.0281868 PubMed 36809531