Skip to main content
Addgene

AAV-CAG-flex-lck-smV5
(Plasmid #196423)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196423 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV-FLEX (Addgene 28304)
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 5077
  • Total vector size (bp) 6457
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Lck-smV5
  • Alt name
    membrane targeted V5 spaghetti monster
  • Alt name
    smFP_V5
  • Species
    Synthetic
  • Insert Size (bp)
    1380
  • Promoter CAG
  • Tag / Fusion Protein
    • Lck (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer ttaaagcagcgtatccacat
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    AAV-CAG-flex-lck-smV5 was created using pAAV-FLEX-GFP (Addgene 28304) provided by Ed Boyden and pCAG_smFP V5 (Addgene 59758) provided by Loren Looger.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CAG-flex-lck-smV5 was a gift from Stanley Thomas Carmichael (Addgene plasmid # 196423 ; http://n2t.net/addgene:196423 ; RRID:Addgene_196423)
  • For your References section:

    A toolbox of astrocyte-specific, serotype-independent adeno-associated viral vectors using microRNA targeting sequences. Gleichman AJ, Kawaguchi R, Sofroniew MV, Carmichael ST. Nat Commun. 2023 Nov 16;14(1):7426. doi: 10.1038/s41467-023-42746-w. 10.1038/s41467-023-42746-w PubMed 37973910