AAV-CAG-dDIO-lck-smMyc-4x6T
(Plasmid #196421)

• Purpose: Dre-dependent AAV expression of membrane-targeted Myc spaghetti monster reporter preferentially in astrocytes; astrocyte selectivity generated with 4x6T miRNA targeting cassette
• Depositing Lab: Stanley Thomas Carmichael
• Publication: Gleichman et al Nat Commun. 2023 Nov 16;14(1):7426. doi: 10.1038/s41467-023-42746-w.

Backbone

• Vector backbone: AAV-FLEX (Addgene 28304)
• Backbone manufacturer: Scott Sternson
• Backbone size w/o insert (bp): 4699
• Total vector size (bp): 6829
• Modifications to backbone: Replaced loxP/lox2272 sites with roxP/rox2 sites; added 4x6T miR targeting cassette for astrocyte selectivity
• Vector type: Mammalian Expression, AAV ; Dre/Rox; astrocyte-selective

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Lck-smMyc
• Alt name: membrane targeted Myc spaghetti monster
• Alt name: smFP_Myc
• Species: Synthetic
• Insert Size (bp): 1224
• Promoter: CAG
• Tag / Fusion Protein:
  • Lck (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGTTCGGCTTCTGGCGTGTGACC
• 3′ sequencing primer: ttaaagcagcgtatccacat

Resource Information

• Supplemental Documents:
  • aav-cag-ddio-lck-smmyc-4x6t.gb
• A portion of this plasmid was derived from a plasmid made by: AAV-CAG-dDIO-lck-smMyc-4x6T was created using pAAV-FLEX-GFP (Addgene 28304) provided by Ed Boyden; dDIO sites (Addgene 55640) provided by Karl Deisseroth; and smFP_Myc (Addgene 59757) provided by Loren Looger.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.02.21.529451v2 for bioRxiv preprint.