AAV-CAG-flex-GFP-4x6T
(Plasmid
#196418)
-
PurposeCre-dependent AAV expression of GFP preferentially in astrocytes; astrocyte selectivity generated with 4x6T miRNA targeting cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196418 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV-FLEX (Addgene 28304)
-
Backbone manufacturerScott Sternson
- Backbone size w/o insert (bp) 5077
- Total vector size (bp) 6326
-
Modifications to backboneAdded 4x6T miRNA targeting cassette for astrocyte selectivity
-
Vector typeMammalian Expression, AAV, Cre/Lox ; Astrocyte-selective
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
-
Alt nameGreen fluorescent protein
-
SpeciesA. victoria
-
Insert Size (bp)720
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer ttaaagcagcgtatccacat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAAV-CAG-flex-GFP-4x6T was created using pAAV-FLEX-GFP (Addgene 28304) provided by Ed Boyden.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.02.21.529451v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CAG-flex-GFP-4x6T was a gift from Stanley Thomas Carmichael (Addgene plasmid # 196418 ; http://n2t.net/addgene:196418 ; RRID:Addgene_196418) -
For your References section:
A toolbox of astrocyte-specific, serotype-independent adeno-associated viral vectors using microRNA targeting sequences. Gleichman AJ, Kawaguchi R, Sofroniew MV, Carmichael ST. Nat Commun. 2023 Nov 16;14(1):7426. doi: 10.1038/s41467-023-42746-w. 10.1038/s41467-023-42746-w PubMed 37973910