AAV-GfaABC1D-Cre-4x6T
(Plasmid #196410)

• Purpose: Astrocytic expression of Cre recombinase in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassette
• Depositing Lab: Stanley Thomas Carmichael
• Publication: Gleichman et al Nat Commun. 2023 Nov 16;14(1):7426. doi: 10.1038/s41467-023-42746-w.

Backbone

• Vector backbone: pAAV-MCS
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 3406
• Total vector size (bp): 5893
• Modifications to backbone: The GfaABC1D promoter and the 4x6T miRNA targeting cassette were added to confer astrocyte specificity.
• Vector type: Mammalian Expression, AAV ; Astrocyte-selective

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cre
• Alt name: Cre recombinase
• Insert Size (bp): 1032
• Promoter: GfaABC1D

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tagcccactccttcataaag
• 3′ sequencing primer: ttattaggacaaggctggtg

Resource Information

• Supplemental Documents:
  • aav-gfaabc1d-cre-4x6t.gb
• A portion of this plasmid was derived from a plasmid made by: AAV-GfaABC1D-Cre-4x6T was created using AAV pmSyn1-EBFP-Cre (Addgene 51507) provided by Hongkui Zeng.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.02.21.529451v2 for bioRxiv preprint.

Information for AAV5 (Catalog # 196410-AAV5)

Purpose

Ready-to-use AAV5 particles produced from AAV-GfaABC1D-Cre-4x6T (#196410). In addition to the viral particles, you will also receive purified AAV-GfaABC1D-Cre-4x6T plasmid DNA.

GfaABC1D driven expression of Cre recombinase in astrocytes. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7×10¹² vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
• Buffer: PBS + 0.001% Poloxamer 188 + 200 mM NaCl
• Serotype: AAV5
• Purification: Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.