Skip to main content
Addgene

pGD-P1/HC-Pro
(Plasmid #196328)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196328 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGD
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tobacco etch virus P1/HC-Pro
  • Alt name
    TEV P1/HC-Pro
  • Species
    tobacco etch virus
  • Promoter duplicated cauliflower mosaic virus 35S promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer 35S promoter/forward primer: CTATCCTTCGCAAGACCCTTC
  • 3′ sequencing primer Nos terminator/reverse primer: TCATCGCAAGACCGGCAA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGD-P1/HC-Pro was a gift from Zhenghe Li (Addgene plasmid # 196328 ; http://n2t.net/addgene:196328 ; RRID:Addgene_196328)

  • For your References section:

    Construction of a Sonchus Yellow Net Virus minireplicon: a step toward reverse genetic analysis of plant negative-strand RNA viruses. Ganesan U, Bragg JN, Deng M, Marr S, Lee MY, Qian S, Shi M, Kappel J, Peters C, Lee Y, Goodin MM, Dietzgen RG, Li Z, Jackson AO. J Virol. 2013 Oct;87(19):10598-611. doi: 10.1128/JVI.01397-13. Epub 2013 Jul 24. 10.1128/JVI.01397-13 PubMed 23885070
Related items:
Commonly requested with: