-
Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSs
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196295 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCB301-2μ-HDV
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
-
Alt nameSpeI-DR-BsaI-BsaI-DR-GFP-SpeI
-
gRNA/shRNA sequenceggagaccgaggtccgaggtctcc
-
SpeciesSynthetic
- Promoter duplicated cauliflower mosaic virus 35S promoter
-
Tag
/ Fusion Protein
- SpeI-DR-BsaI-DR-SpeI (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer 35S promoter/forwarad primer: CTATCCTTCGCAAGACCCTTC
- 3′ sequencing primer Nos terminator/reverse primer: TCATCGCAAGACCGGCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pS-cr:GFP was a gift from Zhenghe Li (Addgene plasmid # 196295 ; http://n2t.net/addgene:196295 ; RRID:Addgene_196295) -
For your References section:
Engineered biocontainable RNA virus vectors for non-transgenic genome editing across crop species and genotypes. Liu Q, Zhao C, Sun K, Deng Y, Li Z. Mol Plant. 2023 Mar 6;16(3):616-631. doi: 10.1016/j.molp.2023.02.003. Epub 2023 Feb 7. 10.1016/j.molp.2023.02.003 PubMed 36751129