Skip to main content
Addgene

pM-CBE
(Plasmid #196293)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196293 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCB301-2μ-HDV
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Full length TSWV M antigenome encoding CBE in place of viral GP
  • Species
    Synthetic
  • Promoter duplicated cauliflower mosaic virus 35S promoter
  • Tag / Fusion Protein
    • 3×flag (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer 35S promoter/forward primer: CTATCCTTCGCAAGACCCTTC
  • 3′ sequencing primer Nos terminator/reverse primer: TCATCGCAAGACCGGCAA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pM-CBE was a gift from Zhenghe Li (Addgene plasmid # 196293 ; http://n2t.net/addgene:196293 ; RRID:Addgene_196293)

  • For your References section:

    Engineered biocontainable RNA virus vectors for non-transgenic genome editing across crop species and genotypes. Liu Q, Zhao C, Sun K, Deng Y, Li Z. Mol Plant. 2023 Mar 6;16(3):616-631. doi: 10.1016/j.molp.2023.02.003. Epub 2023 Feb 7. 10.1016/j.molp.2023.02.003 PubMed 36751129
Related items:
Commonly requested with: