pM-Cas12a
(Plasmid #196291)

• Purpose: 35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding LbCas12a in place of viral GP
• Depositing Lab: Zhenghe Li
• Publication: Liu et al Mol Plant. 2023 Mar 6;16(3):616-631. doi: 10.1016/j.molp.2023.02.003. Epub 2023 Feb 7.

Backbone

• Vector backbone: pCB301-2μ-HDV
• Vector type: Plant Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Full length TSWV M antigenome encoding LbCas12a in place of viral GP
• Alt name: LbCas12a
• Species: Synthetic
• Mutation: See depositor comments below
• Entrez Gene: cas12a (a.k.a. GKE48_RS03395, GKE48_03395)
• Promoter: duplicated cauliflower mosaic virus 35S promoter
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: 35S promoter/forward primer: CTATCCTTCGCAAGACCCTTC
• 3′ sequencing primer: Nos terminator/reverse primer: TCATCGCAAGACCGGCAA

Resource Information

• Supplemental Documents:
  • pM-Cas12a.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains K191N, E695D, and M985I mutations in LbCas12a. These mutations are not known to affect plasmid function.