Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJR152
(Plasmid #196280)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196280 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBA904 (Addgene #122238)
  • Total vector size (bp) 8910
  • Modifications to backbone
    hU6-CR3 cassette cloned using XbaI/NotI
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    hU6-sgRNA-CR3
  • gRNA/shRNA sequence
    gaccaggatgggcaccaccc
  • Species
    Synthetic
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer hU6-F: gagggcctatttcccatgatt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJR152 was a gift from Rebecca Voorhees (Addgene plasmid # 196280 ; http://n2t.net/addgene:196280 ; RRID:Addgene_196280)
  • For your References section:

    A dual sgRNA library design to probe genetic modifiers using genome-wide CRISPRi screens. Guna A, Page KR, Replogle JM, Esantsi TK, Wang ML, Weissman JS, Voorhees RM. BMC Genomics. 2023 Oct 30;24(1):651. doi: 10.1186/s12864-023-09754-y. 10.1186/s12864-023-09754-y PubMed 37904134