Lenti-U6-sgMettl3
(Plasmid
#196263)
-
PurposeExpresses a Mettl3-targeting sgRNA driven by the U6 promoter and Cre-recombinase driven by the PGK promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196263 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLenti-U6-sgRNA/PGK-Cre
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 8000
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMettl3 sgRNA
-
gRNA/shRNA sequenceGGCTTAGGGCCGCTAGAGGT
-
SpeciesM. musculus (mouse)
-
Entrez GeneMettl3 (a.k.a. 2310024F18Rik, M6A, Spo8)
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-U6-sgMettl3 was a gift from Laura Attardi (Addgene plasmid # 196263 ; http://n2t.net/addgene:196263 ; RRID:Addgene_196263) -
For your References section:
The Mettl3 epitranscriptomic writer amplifies p53 stress responses. Raj N, Wang M, Seoane JA, Zhao RL, Kaiser AM, Moonie NA, Demeter J, Boutelle AM, Kerr CH, Mulligan AS, Moffatt C, Zeng SX, Lu H, Barna M, Curtis C, Chang HY, Jackson PK, Attardi LD. Mol Cell. 2022 Jul 7;82(13):2370-2384.e10. doi: 10.1016/j.molcel.2022.04.010. Epub 2022 May 4. 10.1016/j.molcel.2022.04.010 PubMed 35512709