Skip to main content
Addgene

Lenti-U6-sgMettl3
(Plasmid #196263)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196263 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Lenti-U6-sgRNA/PGK-Cre
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 8000
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mettl3 sgRNA
  • gRNA/shRNA sequence
    GGCTTAGGGCCGCTAGAGGT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Mettl3 (a.k.a. 2310024F18Rik, M6A, Spo8)
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-U6-sgMettl3 was a gift from Laura Attardi (Addgene plasmid # 196263 ; http://n2t.net/addgene:196263 ; RRID:Addgene_196263)

  • For your References section:

    The Mettl3 epitranscriptomic writer amplifies p53 stress responses. Raj N, Wang M, Seoane JA, Zhao RL, Kaiser AM, Moonie NA, Demeter J, Boutelle AM, Kerr CH, Mulligan AS, Moffatt C, Zeng SX, Lu H, Barna M, Curtis C, Chang HY, Jackson PK, Attardi LD. Mol Cell. 2022 Jul 7;82(13):2370-2384.e10. doi: 10.1016/j.molcel.2022.04.010. Epub 2022 May 4. 10.1016/j.molcel.2022.04.010 PubMed 35512709
Related items:
Commonly requested with: