pCS2-HA-Mettl3
(Plasmid
#196262)
-
PurposeIn vitro transcription/translation of HA-tagged wild-type Mettl3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCS2-HA-DEST
- Backbone size w/o insert (bp) 4310
- Total vector size (bp) 6053
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMettl3
-
Alt nameMETTL3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1743
-
GenBank IDNM_019721.2
-
Entrez GeneMettl3 (a.k.a. 2310024F18Rik, M6A, Spo8)
- Promoter CMV IE94
-
Tag
/ Fusion Protein
- 3xHA (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GATTTAGGTGACACTATAG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2-HA-Mettl3 was a gift from Laura Attardi (Addgene plasmid # 196262 ; http://n2t.net/addgene:196262 ; RRID:Addgene_196262) -
For your References section:
The Mettl3 epitranscriptomic writer amplifies p53 stress responses. Raj N, Wang M, Seoane JA, Zhao RL, Kaiser AM, Moonie NA, Demeter J, Boutelle AM, Kerr CH, Mulligan AS, Moffatt C, Zeng SX, Lu H, Barna M, Curtis C, Chang HY, Jackson PK, Attardi LD. Mol Cell. 2022 Jul 7;82(13):2370-2384.e10. doi: 10.1016/j.molcel.2022.04.010. Epub 2022 May 4. 10.1016/j.molcel.2022.04.010 PubMed 35512709