Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEM-SNAP-TRIM21
(Plasmid #196181)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 196181 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEM-HE
  • Vector type
    in vitro transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SNAP-TRIM21
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Trim21 (a.k.a. Ro52, Ssa1)
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGTTTAGTGGTAACCAGATCAAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The original SNAP tag sequence was obtained from NEB pSNAPf vector (NEB, N9183S)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEM-SNAP-TRIM21 was a gift from Binyam Mogessie (Addgene plasmid # 196181 ; http://n2t.net/addgene:196181 ; RRID:Addgene_196181)
  • For your References section:

    Actin limits egg aneuploidies associated with female reproductive aging. Dunkley S, Mogessie B. Sci Adv. 2023 Jan 20;9(3):eadc9161. doi: 10.1126/sciadv.adc9161. Epub 2023 Jan 20. 10.1126/sciadv.adc9161 PubMed 36662854