Skip to main content
Addgene

AAVS1_gRNA
(Plasmid #196139)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196139 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Lenti-Cas9-gRNA-GFP
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAVS1 gRNA
  • gRNA/shRNA sequence
    GGCGCTGATACCGTCGGCGT
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1_gRNA was a gift from Jason Sheltzer (Addgene plasmid # 196139 ; http://n2t.net/addgene:196139 ; RRID:Addgene_196139)

  • For your References section:

    Oncogene-like addiction to aneuploidy in human cancers. Girish V, Lakhani AA, Thompson SL, Scaduto CM, Brown LM, Hagenson RA, Sausville EL, Mendelson BE, Kandikuppa PK, Lukow DA, Yuan ML, Stevens EC, Lee SN, Schukken KM, Akalu SM, Vasudevan A, Zou C, Salovska B, Li W, Smith JC, Taylor AM, Martienssen RA, Liu Y, Sun R, Sheltzer JM. Science. 2023 Jul 6:eadg4521. doi: 10.1126/science.adg4521. 10.1126/science.adg4521 PubMed 37410869
Related items:
Commonly requested with: