pEarleyGate 100RMOA mPing
(Plasmid #196137)

• Purpose: Measures mPing transposition in plants
• Depositing Lab: Charles Nathan Hancock
• Publication: Renken et al MicroPubl Biol. 2023 May 16;2023:10.17912/micropub.biology.000793. doi: 10.17912/micropub.biology.000793. eCollection 2023.

Backbone

• Vector backbone: pEarleyGate 100
• Backbone manufacturer: ABRC
• Backbone size w/o insert (bp): 11648
• Total vector size (bp): 15979
• Modifications to backbone: Replaced the 35S promoter with the RPS5a promoter
• Vector type: Plant Expression ; Binary

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Pong TPase LA T2A ORF1SC1 ONE
• Species: Synthetic; Oryza sativa
• Insert Size (bp): 2877
• Mutation: TPase NES sequence mutated L418A, L420A; T2A peptide; ORF1 has Ping N-terminal and Pong C terminal with stronger NLS, N-terminal repeat removed
• GenBank ID: BK000586 AB087616
• Promoter: RPS5a

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: RPS5a_Prom_For - tgatttcgtacttgtgtatttgagctca
• 3′ sequencing primer: OCS_Term_Rev - gaaagcaaatatcatgcgatcataggcgt

Gene/Insert 2

• Gene/Insert name: mPing
• Species: Oryza sativa
• Insert Size (bp): 430
• GenBank ID: AB087615
• Promoter: 35S

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: mPing_Flank_For - agacgttccaaccacgtcttcaaagcaag
• 3′ sequencing primer: mPing_Flank_Rev - cctctccactgacagaaaatttgtgccca

Resource Information

• Supplemental Documents:
  • pEarleyGate100RMOA mPing.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry