pX330_SAFBgRNA8
(Plasmid
#196103)
-
PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196106, 196107, 196108
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330
- Backbone size w/o insert (bp) 8488
- Total vector size (bp) 8508
-
Vector typeMammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSAFB
-
gRNA/shRNA sequenceCGTGGCCATGTGATCCCACG
-
SpeciesM. musculus (mouse)
-
Entrez GeneSafb (a.k.a. 3110021E02Rik, 5330423C17Rik, E130307D12, HAP, HET, SAF-B1, SAFB1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer actatcatatgcttaccgtaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330_SAFBgRNA8 was a gift from Mauro Calabrese (Addgene plasmid # 196103 ; http://n2t.net/addgene:196103 ; RRID:Addgene_196103) -
For your References section:
SAFB associates with nascent RNAs and can promote gene expression in mouse embryonic stem cells. Cherney R, Eberhard Q, Giri G, Mills C, Porrello A, Zhang Z, White D, Trotman JB, Herring L, Dominguez D, Calabrese M. RNA. 2023 Jul 19:rna.079569.122. doi: 10.1261/rna.079569.122. 10.1261/rna.079569.122 PubMed 37468167