CAGGS-SAFB-DD3-NLS-3XFLAG-V5
(Plasmid #196095)

• Purpose: Expresses only the third computationally called disordered domain of mouse SAFB in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tag
• Depositing Lab: Mauro Calabrese
• Publication: Cherney et al RNA. 2023 Jul 19:rna.079569.122. doi: 10.1261/rna.079569.122.

Backbone

• Vector backbone: Addgene Plasmid #196383
• Backbone manufacturer: Genewiz
• Total vector size (bp): 9736
• Modifications to backbone: Insertion of SAFB DD3 ONLY cDNA in AvrII and NotI sites.
• Vector type: Mammalian Expression, Bacterial Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SAFB
• Species: M. musculus (mouse)
• Insert Size (bp): 918
• Mutation: Contains only AA 619-925 (NLS and predicted disordered domain 3) of mouse SAFB protein
• Entrez Gene: Safb (a.k.a. 3110021E02Rik, 5330423C17Rik, E130307D12, HAP, HET, SAF-B1, SAFB1)
• Promoter: CAGGS
• Tags / Fusion Proteins:
  • C-terminal 3xFLAG (C terminal on backbone)
  • C-terminal V5 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GGCTCTAGAGCCTCTGCTAAC

Resource Information

• Supplemental Documents:
  • CAGGS-SAFB-DD3-NLS-3XFLAG-V5.ape
• A portion of this plasmid was derived from a plasmid made by: Azenta (Genewiz)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry