Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CAGGS-safb∆rrm-NLS-3XFLAG-V5
(Plasmid #196093)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 196093 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Addgene Plasmid #196383
  • Backbone manufacturer
    Genewiz
  • Total vector size (bp) 11402
  • Modifications to backbone
    Insertion of SAFB∆RRM cDNA in AvrII and NotI sites.
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SAFB
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2610
  • Mutation
    Removed amino acids 428-506 (RRM) of mouse SAFB protein
  • Entrez Gene
    Safb (a.k.a. 3110021E02Rik, 5330423C17Rik, E130307D12, HAP, HET, SAF-B1, SAFB1)
  • Promoter CAGGS
  • Tags / Fusion Proteins
    • C-terminal 3xFLAG (C terminal on backbone)
    • C-terminal V5 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGCTCTAGAGCCTCTGCTAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAGGS-safb∆rrm-NLS-3XFLAG-V5 was a gift from Mauro Calabrese (Addgene plasmid # 196093 ; http://n2t.net/addgene:196093 ; RRID:Addgene_196093)
  • For your References section:

    SAFB associates with nascent RNAs and can promote gene expression in mouse embryonic stem cells. Cherney R, Eberhard Q, Giri G, Mills C, Porrello A, Zhang Z, White D, Trotman JB, Herring L, Dominguez D, Calabrese M. RNA. 2023 Jul 19:rna.079569.122. doi: 10.1261/rna.079569.122. 10.1261/rna.079569.122 PubMed 37468167