pb-miRE-tre-3xFLAG-hnRNPU∆RGG
(Plasmid #196088)

• Purpose: Expresses mouse hnRNPU lacking RGG domain with a 3xFLAG tag in mammalian cells
• Depositing Lab: Mauro Calabrese
• Publication: Cherney et al RNA. 2023 Jul 19:rna.079569.122. doi: 10.1261/rna.079569.122.

Backbone

• Vector backbone: piggyBac cargo vector
• Backbone manufacturer: System Biosciences
• Total vector size (bp): 9257
• Modifications to backbone: Inserted TRE sequence between SpeI and AgeI sites. Inserted Kozak sequence, 3xFLAG tag sequence, SGS linker sequence, mouse hnrnpU CDS sequence lacking final 154 amino acids, and a stop codon between AgeI and SalI sites.
• Vector type: Mammalian Expression, Bacterial Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SAF-A
• Species: M. musculus (mouse)
• Insert Size (bp): 1938
• Mutation: removed last 154 amino acids on cterminal end
• Entrez Gene: Hnrnpu (a.k.a. Hnrpu, SAFA, Sp120, hnRNP U)
• Promoter: TRE
• Tag / Fusion Protein:
  • N-terminal 3xFLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: TTTGAGCCTGCAGACACCTGG
• 3′ sequencing primer: gcctacctcgacatacgttct

Resource Information

• Supplemental Documents:
  • pb-miRE-tre-3xFLAG-hnRNPU∆RGG.ape
• A portion of this plasmid was derived from a plasmid made by: Genewiz (Azenta)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry