pb-miRE-tre-3xFLAG-hnRNPU
(Plasmid
#196087)
-
PurposeExpresses mouse hnRNPU with a 3xFLAG tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196087 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepiggyBac cargo vector
-
Backbone manufacturerSystem Biosciences
- Total vector size (bp) 9719
-
Modifications to backboneInserted TRE sequence between SpeI and AgeI sites. Inserted Kozak sequence, 3xFLAG tag sequence, SGS linker sequence, mouse hnrnpU CDS sequence, and a stop codon between AgeI and SalI sites.
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSAF-A
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2400
-
Entrez GeneHnrnpu (a.k.a. Hnrpu, SAFA, Sp120, hnRNP U)
- Promoter TRE
-
Tag
/ Fusion Protein
- N-terminal 3xFLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer TTTGAGCCTGCAGACACCTGG
- 3′ sequencing primer gcctacctcgacatacgttct (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGenewiz (Azenta)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pb-miRE-tre-3xFLAG-hnRNPU was a gift from Mauro Calabrese (Addgene plasmid # 196087 ; http://n2t.net/addgene:196087 ; RRID:Addgene_196087) -
For your References section:
SAFB associates with nascent RNAs and can promote gene expression in mouse embryonic stem cells. Cherney R, Eberhard Q, Giri G, Mills C, Porrello A, Zhang Z, White D, Trotman JB, Herring L, Dominguez D, Calabrese M. RNA. 2023 Jul 19:rna.079569.122. doi: 10.1261/rna.079569.122. 10.1261/rna.079569.122 PubMed 37468167