pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
(Plasmid #196082)

• Purpose: (Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.
• Depositing Lab: Joanna Bereta
• Publication: Czarnek et al Mol Biotechnol. 2023 Jan 28. doi: 10.1007/s12033-023-00675-5.

Backbone

• Vector backbone: pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-SapI
• Backbone manufacturer: Czarnek et al., 2021
• Total vector size (bp): 11264
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: dCas9-KRAB-MeCP2 repressor
• Species: Streptococcus pyogenes
• Insert Size (bp): 5313
• Mutation: Catalytically dead mutant of the Cas9 endonuclease from the Streptococcus pyogenes Type II CRISPR/Cas system (Cas9m4) fused with Krüppel-associated box (KRAB) transcriptional repression domain from the human zinc finger protein ZNF1 (Margolin et al., 1994) and transcriptional repression domain from rat methyl-CpG-binding protein 2 (Nan et al., 1997).

Gene/Insert 2

• Gene/Insert name: hU6 promoter and gRNA scaffold
• Species: H. sapiens (human); Streptococcus pyogenes
• Insert Size (bp): 343
• Mutation: hU6 promoter and gRNA scaffold containing SapI sites were amplified from pX330 containing SapI sites instead of BbsI sites (Czarnek et al., 2021).

Gene/Insert 3

• Gene/Insert name: Aminoglycoside phosphotransferase
• Species: E.coli
• Insert Size (bp): 399

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTACTAACTTCAGCCTGCTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains a T99M mutation in HygR. This mutation is not expected to affect plasmid function.