YW347_Ptbb2UTR-loxP-RFP-miniMOS
(Plasmid
#196064)
-
Purposea plasmid modified from miniMOS vector pCFJ910. the modification including insertions of myo2p::TagRFP downstream to NeoR CDS and 2 loxP sites flanking the NeoR and tagRFP cassettes.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196064 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCFJ910
- Backbone size w/o insert (bp) 5496
- Total vector size (bp) 7476
-
Vector typeWorm Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemyo2p driven tagRFP
-
SpeciesC. elegans (nematode)
- Promoter myo-2
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cattttatatctgagtagtacctttgc
- 3′ sequencing primer ttacttgtacagctcgtccatg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNeoR
-
SpeciesC. elegans (nematode)
Gene/Insert 3
-
Gene/Insert nameMinimal Mos1
-
SpeciesD. melanogaster (fly), C. elegans (nematode)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YW347_Ptbb2UTR-loxP-RFP-miniMOS was a gift from Wenxing Yang (Addgene plasmid # 196064 ; http://n2t.net/addgene:196064 ; RRID:Addgene_196064) -
For your References section:
A new miniMOS tool kit capable of visualizing single copy insertion in C. elegans. Li J, Qin Y, Shen C, Zhang J, Tu S, Yang J, Wang Y, Zhou R, Zhang K, Chen J, Yang W. PeerJ. 2023 May 17;11:e15433. doi: 10.7717/peerj.15433. eCollection 2023. 10.7717/peerj.15433 PubMed 37214099