YW347_Ptbb2UTR-loxP-RFP-miniMOS
(Plasmid #196064)

• Purpose: a plasmid modified from miniMOS vector pCFJ910. the modification including insertions of myo2p::TagRFP downstream to NeoR CDS and 2 loxP sites flanking the NeoR and tagRFP cassettes.
• Depositing Lab: Wenxing Yang
• Publication: Li et al PeerJ. 2023 May 17;11:e15433. doi: 10.7717/peerj.15433. eCollection 2023.

Backbone

• Vector backbone: pCFJ910
• Backbone size w/o insert (bp): 5496
• Total vector size (bp): 7476
• Vector type: Worm Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: myo2p driven tagRFP
• Species: C. elegans (nematode)
• Promoter: myo-2

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cattttatatctgagtagtacctttgc
• 3′ sequencing primer: ttacttgtacagctcgtccatg

Gene/Insert 2

• Gene/Insert name: NeoR
• Species: C. elegans (nematode)

Gene/Insert 3

• Gene/Insert name: Minimal Mos1
• Species: D. melanogaster (fly), C. elegans (nematode)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry