TRUPATH Triple Ga15
(Plasmid #196060)

• Purpose: Encodes a G alpha subunit (GNA15) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteins
• Depositing Lab: Justin English
• Publication: Olsen et al Nat Chem Biol. 2020 May 4. pii: 10.1038/s41589-020-0535-8. doi: 10.1038/s41589-020-0535-8.

Backbone

• Vector backbone: pcDNA3.1(+)
• Backbone manufacturer: Genscript
• Backbone size w/o insert (bp): 5075
• Total vector size (bp): 9922
• Vector type: Mammalian Expression, Luciferase
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: GAlpha15-RLuc8
• Alt name: GNA15
• Species: H. sapiens (human)
• Insert Size (bp): 2112
• Mutation: RLuc8 and flanking SGGGGS linkers have been inserted at amino acid position 245 of the alpha subunit
• Entrez Gene: GNA15 (a.k.a. GNA16, HG1L)
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: gccacgttgtgagttggatag
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Gene/Insert 2

• Gene/Insert name: GGamma13-GFP2
• Alt name: GNG13
• Species: H. sapiens (human)
• Insert Size (bp): 933
• Entrez Gene: GNG13 (a.k.a. G(gamma)13, HG3J, h2-35)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP2 and GSAG linker (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: gagggcagaggaagtcttc
• 3′ sequencing primer: GATTTAGGTGACACTATAG

Gene/Insert 3

• Gene/Insert name: GBeta3
• Alt name: GNB3
• Species: H. sapiens (human)
• Insert Size (bp): 1020
• Entrez Gene: GNB3 (a.k.a. CSNB1H, HG2D)
• Promoter: CMV

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: ccggtagggccgggattc

Resource Information

• Supplemental Documents:
  • 196060_trupath-triple-ga15 (1).gb
• A portion of this plasmid was derived from a plasmid made by: AddgeneTRUPATH Kit #1000000163

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry