TRUPATH Triple GaoA
(Plasmid
#196051)
-
PurposeEncodes a G alpha subunit (GNAO1 Isoform Alpha 1) with RLuc8, a G gamma subunit (GNG8) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196051 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1(+)
-
Backbone manufacturerGenscript
- Backbone size w/o insert (bp) 5075
- Total vector size (bp) 9803
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGAlphaoA-RLuc8
-
Alt nameGNAO1 (Isoform Alpha-1)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2031
-
MutationRLuc8 and flanking SGGGGS linkers have been inserted at amino acid position 92 of the alpha subunit
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer gccacgttgtgagttggatag
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGGamma8-GFP2
-
Alt nameGNG8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)942
-
Entrez GeneGNG8
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP2 and GSAG linker (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer gagggcagaggaagtcttc
- 3′ sequencing primer GATTTAGGTGACACTATAG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameGBeta3
-
Alt nameGNB3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1020
-
Entrez GeneGNB3 (a.k.a. CSNB1H, HG2D)
- Promoter CMV
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ccggtagggccgggattc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgeneTRUPATH Kit #1000000163
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRUPATH Triple GaoA was a gift from Justin English (Addgene plasmid # 196051 ; http://n2t.net/addgene:196051 ; RRID:Addgene_196051) -
For your References section:
TRUPATH, an open-source biosensor platform for interrogating the GPCR transducerome. Olsen RHJ, DiBerto JF, English JG, Glaudin AM, Krumm BE, Slocum ST, Che T, Gavin AC, McCorvy JD, Roth BL, Strachan RT. Nat Chem Biol. 2020 May 4. pii: 10.1038/s41589-020-0535-8. doi: 10.1038/s41589-020-0535-8. 10.1038/s41589-020-0535-8 PubMed 32367019