pCEC-red
(Plasmid #196040)

• Purpose: (Empty Backbone) Allows the expression of Cas9 in Saccharomyces cerevisiae and contains a gRNA expression unit with a mRFP1 placeholder for user-defined gRNA insertion using BsaI-mediated Golden Gate Assembly
• Depositing Lab: Paola Branduardi
• Publication: Maestroni et al FEMS Yeast Res. 2023 Jan 4;23:foad002. doi: 10.1093/femsyr/foad002.

Backbone

• Vector backbone: pCEC-red
• Backbone manufacturer: IndBioTech Lab
• Backbone size (bp): 10373
• Modifications to backbone: The backbone was synthetically assembled from parts of other plasmids. It bears an mRFP1 placeholder that is excided upon cloning
• Vector type: Yeast Expression, CRISPR, Synthetic Biology ; gRNA cloning
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• 3′ sequencing primer: CTAGATTTTGTAGTGCCCTC

Resource Information

• Supplemental Documents:
  • pCEC_red.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid was synthetically assembled from parts of other vectors: GGE114 (a gift from Tristan Rossignol (Addgene plasmid # 120731 ; http://n2t.net/addgene:120731 ; RRID:Addgene_120731)); pML104 (a gift from John Wyrick (Addgene plasmid # 67638 ; http://n2t.net/addgene:67638 ; RRID:Addgene_67638); pGGA_KANMX (unpublished)