XA106+pRCPam
(Bacterial strain #195858)

• Purpose: E. coli nonsense suppressor strain (leuX) transformed with plasmid carrying chromogenic protein (CP) with amber nonsense mutation in chromophore. Grows magenta when CP is induced with rhamnose.
• Depositing Lab: Gregory Phillips
• Publication: DeWolf et al J Microbiol Biol Educ. 2023 Oct 25;24(3):e00094-23. doi: 10.1128/jmbe.00094-23. eCollection 2023 Dec.

Backbone

• Vector backbone: n/a
• Vector type: This is a strain carrying pRCPam

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XA106
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Amber Chromogenic Protein on pRCPam plasmid
• Species: Acropora millepora
• Mutation: Gln62X in amber chromogenic protein

Cloning Information

• Cloning method: Unknown

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Primer sequences for confirmation of suppressor mutation:

Sense PCR primer (5'-->3') - TCCTTCTCTGGTGTTGTTTG
Antisense PCR primer (5'-->3') - TTGGCTGCTCTGACTTTG
Sequencing primer (5'-->3') - CGGTTGACCTTGAGAGAGTTAAT