Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

XA103+pRCPam
(Bacterial strain #195857)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 195857 Bacteria in agar stab 1 $85

Backbone

  • Vector backbone
    n/a
  • Vector type
    This is a strain carrying pRCPam

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XA103
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Amber Chromogenic Protein on pRCPam plasmid
  • Species
    Acropora millepora
  • Mutation
    Gln62X in amber chromogenic protein

Cloning Information

  • Cloning method Unknown

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Primer sequences for confirmation of suppressor mutation:

Sense PCR primer (5'-->3') - TTGAGGTAATGCTTGAGATGG
Antisense PCR primer (5'-->3') - TCCTGCCAGCGTTTATTG
Sequencing primer (5'-->3') - CACAGCGCGTCTTTGTTTAC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    XA103+pRCPam was a gift from Gregory Phillips (Addgene plasmid # 195857)
  • For your References section:

    Changing colors and understanding: the use of mutant chromogenic protein and informational suppressor strains of Escherichia coli to explore the central dogma of molecular biology. DeWolf S, Van den Bogaard M, Hart RB, Hartman S, Boury N, Phillips GJ. J Microbiol Biol Educ. 2023 Oct 25;24(3):e00094-23. doi: 10.1128/jmbe.00094-23. eCollection 2023 Dec. 10.1128/jmbe.00094-23 PubMed 38107993