pAS3-lim-4P_gtACR2_SL2_eGFP(65C)_unc-54 3'UTR
(Plasmid
#195853)
-
PurposeExpresses inhibitory opsin gtACR2 and GFP in turning associated neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195853 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAS3
-
Backbone manufacturerAnuj Sharma
- Total vector size (bp) 9095
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGuillardia theta anion-conducting channelrhodopsin-2 (GtACR2)
-
SpeciesGuillardia theta
-
Insert Size (bp)873
- Promoter lim-4
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gtaacgccagggttttcccag
- 3′ sequencing primer caggaaacagctatgaccatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.48550/arXiv.2301.02709 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAS3-lim-4P_gtACR2_SL2_eGFP(65C)_unc-54 3'UTR was a gift from Andrew Leifer (Addgene plasmid # 195853 ; http://n2t.net/addgene:195853 ; RRID:Addgene_195853) -
For your References section:
Inhibitory feedback from the motor circuit gates mechanosensory processing in Caenorhabditis elegans. Kumar S, Sharma AK, Tran A, Liu M, Leifer AM. PLoS Biol. 2023 Sep 21;21(9):e3002280. doi: 10.1371/journal.pbio.3002280. eCollection 2023 Sep. 10.1371/journal.pbio.3002280 PubMed 37733772