Skip to main content
Addgene

pAS3-lim-4P_gtACR2_SL2_eGFP(65C)_unc-54 3'UTR
(Plasmid #195853)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195853 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAS3
  • Backbone manufacturer
    Anuj Sharma
  • Total vector size (bp) 9095
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Guillardia theta anion-conducting channelrhodopsin-2 (GtACR2)
  • Species
    Guillardia theta
  • Insert Size (bp)
    873
  • Promoter lim-4

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gtaacgccagggttttcccag
  • 3′ sequencing primer caggaaacagctatgaccatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.48550/arXiv.2301.02709 for preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAS3-lim-4P_gtACR2_SL2_eGFP(65C)_unc-54 3'UTR was a gift from Andrew Leifer (Addgene plasmid # 195853 ; http://n2t.net/addgene:195853 ; RRID:Addgene_195853)
  • For your References section:

    Inhibitory feedback from the motor circuit gates mechanosensory processing in Caenorhabditis elegans. Kumar S, Sharma AK, Tran A, Liu M, Leifer AM. PLoS Biol. 2023 Sep 21;21(9):e3002280. doi: 10.1371/journal.pbio.3002280. eCollection 2023 Sep. 10.1371/journal.pbio.3002280 PubMed 37733772