Skip to main content
Addgene

pLenti HsATP13A3 D498N
(Plasmid #195850)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195850 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    lentiviral transferplasmid
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 11397
  • Total vector size (bp) 15078
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ATPase 13A3 D498N
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3681
  • Entrez Gene
    ATP13A3 (a.k.a. AFURS1, PPH5)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer GCAAATGGGCGGTAGGCGT
  • 3′ sequencing primer CAGACCTTGCATTCCTTTGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti HsATP13A3 D498N was a gift from Veerle Baekelandt (Addgene plasmid # 195850 ; http://n2t.net/addgene:195850 ; RRID:Addgene_195850)

  • For your References section:

    Novel Green Fluorescent Polyamines to Analyze ATP13A2 and ATP13A3 Activity in the Mammalian Polyamine Transport System. Houdou M, Jacobs N, Coene J, Azfar M, Vanhoutte R, Van den Haute C, Eggermont J, Daniels V, Verhelst SHL, Vangheluwe P. Biomolecules. 2023 Feb 9;13(2):337. doi: 10.3390/biom13020337. 10.3390/biom13020337 PubMed 36830711
Related items: