P-BT2818
(Plasmid
#195742)
-
PurposepBolux harboring the promoter region upstream of BT2818
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBolux
- Backbone size w/o insert (bp) 13807
- Total vector size (bp) 14107
-
Vector typeBacterial Expression
-
Selectable markersTetracycline in Bacteroides species
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameThe B. thetaiotaomicron BT2818 promoter cloned into pBolux
-
SpeciesBacteroides thetaiotaomicron
-
Insert Size (bp)300
- Promoter BT2818
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC
- 3′ sequencing primer TGCGGACGTCAAATCAACAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P-BT2818 was a gift from Guy Townsend (Addgene plasmid # 195742 ; http://n2t.net/addgene:195742 ; RRID:Addgene_195742) -
For your References section:
Harnessing gut microbes for glycan detection and quantification. Modesto JL, Pearce VH, Townsend GE 2nd. Nat Commun. 2023 Jan 17;14(1):275. doi: 10.1038/s41467-022-35626-2. 10.1038/s41467-022-35626-2 PubMed 36650134